Mature sequence ath-miR5648-3p

Accession numberMIMAT0022413
IDath-miR5648-3p
Stem-Loop ath-MIR5648
Sequence
aucugaagaaaauagcggcau
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).