Mature sequence hsa-miR-374c-3p

Accession numberMIMAT0022735
IDhsa-miR-374c-3p
Stem-Loop hsa-mir-374c
Sequence
cacuuagcagguuguauuauau
Get sequence
Deep sequencing3490 reads, 127 experiments
Predicted targets

References

1