Mature sequence hsa-miR-550b-2-5p

Accession numberMIMAT0022737
IDhsa-miR-550b-2-5p
Stem-Loop hsa-mir-550b-1 hsa-mir-550b-2
Sequence
augugccugagggaguaagaca
Get sequence
Deep sequencing5751 reads, 89 experiments
Predicted targets

References

1