Mature sequence sha-let-7a

Accession numberMIMAT0022801
IDsha-let-7a
Stem-Loop sha-let-7a
Sequence
ugagguaguagguuguauagu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:20044575 "The Tasmanian devil transcriptome reveals Schwann cell origins of a clonally transmissible cancer" Murchison EP, Tovar C, Hsu A, Bender HS, Kheradpour P, Rebbeck CA, Obendorf D, Conlan C, Bahlo M, Blizzard CA, Pyecroft S, Kreiss A, Kellis M, Stark A, Harkins TT, Marshall Graves JA, Woods GM, Hannon GJ, Papenfuss AT Science. 327:84-87(2010).