Mature sequence hsa-miR-939-3p

Accession numberMIMAT0022939
IDhsa-miR-939-3p
Stem-Loop hsa-mir-939
Sequence
cccugggccucugcuccccag
Get sequence
Deep sequencing107 reads, 58 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).