Mature sequence hsa-miR-1238-5p

Accession numberMIMAT0022947
IDhsa-miR-1238-5p
Stem-Loop hsa-mir-1238
Sequence
gugagugggagccccagugugug
Get sequence
Deep sequencing1 reads, 1 experiments
Predicted targets

References

1
PMID:17964270 "Mammalian mirtron genes" Berezikov E, Chung WJ, Willis J, Cuppen E, Lai EC Mol Cell. 28:328-336(2007).