Mature sequence ssc-miR-146a-5p

Accession numberMIMAT0022963
IDssc-miR-146a-5p
Stem-Loop ssc-mir-146a
Sequence
ugagaacugaauuccauggguu
Get sequence
Deep sequencing5853 reads, 15 experiments

References

1
PMID:20433717 "Deciphering the porcine intestinal microRNA transcriptome" Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R BMC Genomics. 11:275(2010).
2
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).