Mature sequence bra-miR1885b

Accession numberMIMAT0023015
IDbra-miR1885b
Stem-Loop bra-MIR1885b
Sequence
uacaucuucuccgcggaagcuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).