Mature sequence spu-miR-92d

Accession numberMIMAT0023512
IDspu-miR-92d
Stem-Loop spu-mir-92d
Sequence
uauugcacuuaccccggcug
Get sequence
Deep sequencing reads, experiments

References

1