Mature sequence spu-miR-92e

Accession numberMIMAT0023513
IDspu-miR-92e
Stem-Loop spu-mir-92e
Sequence
uauugcacuuaccccggcuua
Get sequence
Deep sequencing reads, experiments

References

1