Mature sequence ggo-miR-1301

Accession numberMIMAT0024158
IDggo-miR-1301
Stem-Loop ggo-mir-1301
Sequence
uugcagcugccugggagugacu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22453055 "Annotation of primate miRNAs by high throughput sequencing of small RNA libraries" Dannemann M, Nickel B, Lizano E, Burbano HA, Kelso J BMC Genomics. 13:116(2012).