Mature sequence bta-miR-2285h

Accession numberMIMAT0024583
IDbta-miR-2285h
Stem-Loop bta-mir-2285h
Sequence
gaaaaccgaaacgaacuuuaug
Get sequence
Deep sequencing61 reads, 35 experiments
Predicted targets

References

1
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).