Mature sequence bta-miR-2285k

Accession numberMIMAT0024586
IDbta-miR-2285k
Stem-Loop bta-mir-2285k-1 bta-mir-2285k-2 bta-mir-2285k-3 bta-mir-2285k-4 bta-mir-2285k-5
Sequence
aaaaccggaaugaacuuuuug
Get sequence
Deep sequencing47879 reads, 78 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
2
PMID:22298343 "Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells" Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA J Cell Biochem. 113:2098-2111(2012).