Mature sequence hbr-miR6167

Accession numberMIMAT0024785
IDhbr-miR6167
Stem-Loop hbr-MIR6167
Sequence
uacccagguggaagcuuuga
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22407387 "Genome-wide analysis of microRNAs in rubber tree (Hevea brasiliensis L.) using high-throughput sequencing" Lertpanyasampatha M, Gao L, Kongsawadworakul P, Viboonjun U, Chrestin H, Liu R, Chen X, Narangajavana J Planta. 236:437-445(2012).