Mature sequence gma-miR166t

Accession numberMIMAT0024902
IDgma-miR166t
Stem-Loop gma-MIR166t
Sequence
ucggaccaggcuucauuccc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).