Mature sequence gma-miR166u

Accession numberMIMAT0024903
IDgma-miR166u
Stem-Loop gma-MIR166u
Sequence
ucucggaccaggcuucauuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).