Mature sequence gma-miR393h

Accession numberMIMAT0024915
IDgma-miR393h
Stem-Loop gma-MIR393h
Sequence
uuccaaagggaucgcauugauc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).