Mature sequence gma-miR395j

Accession numberMIMAT0024922
IDgma-miR395j
Stem-Loop gma-MIR395j
Sequence
augaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22559273 "Genome organization and characteristics of soybean microRNAs" Turner M, Yu O, Subramanian S BMC Genomics. 13:169(2012).