Mature sequence sma-miR-3479-3p

Accession numberMIMAT0025039
IDsma-miR-3479-3p
Stem-Loop sma-mir-3479
Sequence
uauugcacuaaccuucgccuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:21640815 "Genome-wide identification of novel microRNAs and their target genes in the human parasite Schistosoma mansoni" de Souza Gomes M, Muniyappa MK, Carvalho SG, Guerra-Sa R, Spillane C Genomics. 98:96-111(2011).