Mature sequence ssc-miR-20b

Accession numberMIMAT0025359
IDssc-miR-20b
Stem-Loop ssc-mir-20b-1 ssc-mir-20b-2
Sequence
caaagugcucacagugcagguag
Get sequence
Deep sequencing2498 reads, 13 experiments

References

1
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
2
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).