Mature sequence bta-miR-2285o

Accession numberMIMAT0025530
IDbta-miR-2285o
Stem-Loop bta-mir-2285o-1 bta-mir-2285o-2 bta-mir-2285o-3 bta-mir-2285o-4 bta-mir-2285o-5
Sequence
aaacccgaacgaacuuuugg
Get sequence
Deep sequencing17940 reads, 65 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).
2