Mature sequence bta-miR-2285m

• Accession number: MIMAT0025533
• ID: bta-miR-2285m
• Stem-Loop: bta-mir-2285m-1 bta-mir-2285m-2 bta-mir-2285m-3 bta-mir-2285m-4 bta-mir-2285m-5
• Sequence: aaaacgcaaaugaacuuuuugg
• Deep sequencing: 610 reads, 62 experiments
• Predicted targets:
  • TargetScanVert:bta-miR-2285m

References

1. PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).