Mature sequence bta-miR-3957

Accession numberMIMAT0025548
IDbta-miR-3957
Stem-Loop bta-mir-3957
Sequence
cucggagagugcagcugugg
Get sequence
Deep sequencing160 reads, 46 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).