Mature sequence bta-miR-6526

Accession numberMIMAT0025556
IDbta-miR-6526
Stem-Loop bta-mir-6526-1 bta-mir-6526-2 bta-mir-6526-3
Sequence
uccugugccucgaauggguaug
Get sequence
Deep sequencing213 reads, 38 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).