Mature sequence bta-miR-2284aa

Accession numberMIMAT0025560
IDbta-miR-2284aa
Stem-Loop bta-mir-2284aa-1 bta-mir-2284aa-2 bta-mir-2284aa-3 bta-mir-2284aa-4
Sequence
aaaaaaguuuguuuggguuuu
Get sequence
Deep sequencing42697 reads, 73 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).