Mature sequence bta-miR-6536

Accession numberMIMAT0025572
IDbta-miR-6536
Stem-Loop bta-mir-6536-1 bta-mir-6536-2
Sequence
uuuaaguauacgaugaacugc
Get sequence
Deep sequencing85 reads, 17 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).