Mature sequence bta-miR-2285s

Accession numberMIMAT0025576
IDbta-miR-2285s
Stem-Loop bta-mir-2285s
Sequence
aagacccaagugaacucuuugg
Get sequence
Deep sequencing30 reads, 24 experiments
Predicted targets

References

1
PMID:21912509 "Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle" Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J Int J Biol Sci. 7:1016-1026(2011).