Mature sequence gga-miR-6557-5p

Accession numberMIMAT0025828
IDgga-miR-6557-5p
Stem-Loop gga-mir-6557
Sequence
ccggaggagcccggcgcugc
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).