Mature sequence mdm-miR395c

Accession numberMIMAT0025982
IDmdm-miR395c
Stem-Loop mdm-MIR395c
Sequence
cugaaguguuugggggaacuc
Get sequence
Deep sequencing reads, experiments

References

1
PMID:22704043 "Apple miRNAs and tasiRNAs with novel regulatory networks" Xia R, Zhu H, An YQ, Beers EP, Liu Z Genome Biol. 13:R47(2012).