Mature sequence gga-miR-30b-3p

Accession numberMIMAT0026512
IDgga-miR-30b-3p
Stem-Loop gga-mir-30b
Sequence
cugggggguggauguuuacuuc
Get sequence
Deep sequencing77 reads, 5 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
3
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
4
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
5
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).