Mature sequence hsa-miR-519d-5p

Accession numberMIMAT0026610
IDhsa-miR-519d-5p
Stem-Loop hsa-mir-519d
Sequence
ccuccaaagggaagcgcuuucuguu
Get sequence
Deep sequencing24 reads, 10 experiments
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).