Mature sequence gga-miR-489-5p

Accession numberMIMAT0026632
IDgga-miR-489-5p
Stem-Loop gga-mir-489
Sequence
uggucguauguaugacgucauu
Get sequence
Deep sequencing116 reads, 3 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).