Mature sequence gga-miR-2188-3p

Accession numberMIMAT0027028
IDgga-miR-2188-3p
Stem-Loop gga-mir-2188
Sequence
gauauauguggucagaccuauc
Get sequence
Deep sequencing9205 reads, 5 experiments
Predicted targets

References

1
PMID:19891781 "Identification of differentially expressed miRNAs in chicken lung and trachea with avian influenza virus infection by a deep sequencing approach" Wang Y, Brahmakshatriya V, Zhu H, Lupiani B, Reddy SM, Yoon BJ, Gunaratne PH, Kim JH, Chen R, Wang J, Zhou H BMC Genomics. 10:512(2009).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).