Mature sequence pgi-miR6136b

Accession numberMIMAT0027255
IDpgi-miR6136b
Stem-Loop pgi-MIR6136b
Sequence
ucauacaaccgucgucuauac
Get sequence
Deep sequencing reads, experiments

References

1