Mature sequence mmu-miR-6914-5p

Accession numberMIMAT0027728
IDmmu-miR-6914-5p
Stem-Loop mmu-mir-6914
Sequence
uccugggguggugguggccacaga
Get sequence
Deep sequencing4 reads, 4 experiments
Predicted targets

References

1
PMID:22955976 "Discovery of hundreds of mirtrons in mouse and human small RNA data" Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC Genome Res. 22:1634-1645(2012).