Mature sequence mdo-miR-7359a-3p

Accession numberMIMAT0028731
IDmdo-miR-7359a-3p
Stem-Loop mdo-mir-7359a-1 mdo-mir-7359a-2 mdo-mir-7359a-3 mdo-mir-7359a-4 mdo-mir-7359a-5
Sequence
ucauagccuuucacauucuuag
Get sequence
Deep sequencing185 reads, 2 experiments
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).