Mature sequence ipu-let-7a

Accession numberMIMAT0029374
IDipu-let-7a
Stem-Loop ipu-let-7a-7 ipu-let-7a-1 ipu-let-7a-3 ipu-let-7a-5 ipu-let-7a-6 ipu-let-7a-4 ipu-let-7a-2
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments

References

1