Mature sequence ipu-let-7c

Accession numberMIMAT0029376
IDipu-let-7c
Stem-Loop ipu-let-7c-1 ipu-let-7c-2
Sequence
ugagguaguagguuguaugguu
Get sequence
Deep sequencing reads, experiments

References

1