Mature sequence ipu-let-7d

Accession numberMIMAT0029377
IDipu-let-7d
Stem-Loop ipu-let-7d-2 ipu-let-7d-1
Sequence
ugagguaguugguuguaugguu
Get sequence
Deep sequencing reads, experiments

References

1