Mature sequence ipu-let-7e

Accession numberMIMAT0029378
IDipu-let-7e
Stem-Loop ipu-let-7e-2 ipu-let-7e-1
Sequence
ugagguaguagauugaauaguu
Get sequence
Deep sequencing reads, experiments

References

1