Mature sequence ipu-let-7i

Accession numberMIMAT0029382
IDipu-let-7i
Stem-Loop ipu-let-7i
Sequence
ugagguaguaguuugugcuguu
Get sequence
Deep sequencing reads, experiments

References

1