Mature sequence ipu-let-7j

Accession numberMIMAT0029383
IDipu-let-7j
Stem-Loop ipu-let-7j-1 ipu-let-7j-2
Sequence
ugagguaguuguuuguacaguu
Get sequence
Deep sequencing reads, experiments

References

1