Mature sequence ipu-miR-7577

Accession numberMIMAT0029576
IDipu-miR-7577
Stem-Loop ipu-mir-7577
Sequence
cucggacauuuuggacucgga
Get sequence
Deep sequencing reads, experiments

References

1