Mature sequence cbr-miR-124c

Accession numberMIMAT0029608
IDcbr-miR-124c
Stem-Loop cbr-mir-124c
Sequence
uaaggcacuuccaagccguac
Get sequence
Deep sequencing reads, experiments

References

1