Mature sequence cbn-miR-55

Accession numberMIMAT0029688
IDcbn-miR-55
Stem-Loop cbn-mir-55
Sequence
uacccguauauauuucugcuuag
Get sequence
Deep sequencing reads, experiments

References

1