Mature sequence cbn-miR-64i

Accession numberMIMAT0029706
IDcbn-miR-64i
Stem-Loop cbn-mir-64i-1 cbn-mir-64i-2
Sequence
uaugacacggaucaaugcuugac
Get sequence
Deep sequencing reads, experiments

References

1