Mature sequence mmu-miR-219b-5p

Accession numberMIMAT0029806
IDmmu-miR-219b-5p
Stem-Loop mmu-mir-219b
Sequence
agauguccagccacaauucucg
Get sequence
Deep sequencing13 reads, 9 experiments
Predicted targets

References

1