Mature sequence mmu-miR-219b-3p

Accession numberMIMAT0029807
IDmmu-miR-219b-3p
Stem-Loop mmu-mir-219b
Sequence
agaauugcguuuggacaaucagu
Get sequence
Deep sequencing175 reads, 52 experiments
Predicted targets

References

1