Mature sequence mmu-miR-7665-5p

Accession numberMIMAT0029836
IDmmu-miR-7665-5p
Stem-Loop mmu-mir-7665
Sequence
aagggaaggcaggagaaaggcug
Get sequence
Deep sequencing61 reads, 29 experiments
Predicted targets

References

1