Mature sequence mmu-miR-7665-3p

Accession numberMIMAT0029837
IDmmu-miR-7665-3p
Stem-Loop mmu-mir-7665
Sequence
agccaggucccuguccccuaca
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1